Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU155811

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCCTCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGCACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCTCATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCACTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCGCCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTACCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGGGGTTTGTCTGGCATAGCCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shixiong Wang et al.
International journal of molecular sciences, 19(12) (2018-12-24)
Forkhead box A1 (FOXA1) belongs to the forkhead class transcription factor family, playing pioneering function for hormone receptors in breast and prostate cancers, and mediating activation of linage specific enhancers. Interplay between FOXA1 and breast cancer specific signaling pathways has
Shijun Lu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 69(7), 645-656 (2020-04-29)
Nowadays, sepsis-induced acute kidney injury (AKI) has gradually become a global problem for its high incidence and increasing mortality. Previous study has reported lncRNA ENST00000452391.1 in sepsis patients. However, its potential biological function and downstream molecular mechanism are still mysterious.
Shannon Whirledge et al.
Endocrinology, 158(11), 4076-4092 (2017-09-25)
Successful pregnancy relies on dynamic control of cell signaling to achieve uterine receptivity and the necessary biological changes required for endometrial decidualization, embryo implantation, and fetal development. Glucocorticoids are master regulators of intracellular signaling and can directly regulate embryo implantation
Erina Anzai et al.
Biological & pharmaceutical bulletin, 40(9), 1483-1489 (2017-09-05)
Epithelial-to-mesenchymal transition (EMT) is an important process during embryonic development and tumor progression by which adherent epithelial cells acquire mesenchymal properties. Forkhead box protein A1 (FOXA1) is a transcriptional regulator preferentially expressed in epithelial breast cancer cells, and its expression
Suzie K Hight et al.
Neoplasia (New York, N.Y.), 22(8), 294-310 (2020-06-09)
Using a mini-library of 1062 lentiviral shRNAs targeting 40 nuclear hormone receptors and 70 of their co-regulators, we searched for potential therapeutic targets that would be important during in vivo tumor growth using a parallel in vitro and in vivo

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique