Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU154411

Sigma-Aldrich

MISSION® esiRNA

targeting human AHCY

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGCAAGCTGAATGTGAAGTTGACCAAGCTAACTGAGAAGCAAGCCCAGTACCTGGGCATGTCCTGTGATGGCCCCTTCAAGCCGGATCACTACCGCTACTGAGAGCCAGGTCTGCGTTTCACCCTCCAGCTGCTGTCCTTGCCCAGGCCCCACCTCTCCTCCCTAAGAGCTAATGGCACCAACTTTGTGATTGGTTTGTCAGTGTCCCCCATCGACTCTCTGGGGCTGATCACTTAGTTTTTGGCCTCTGCTGCAGCCGTCATACTGTTCCAAATGTGGCAGCGGGAACAGAGTACCCTCTTCAAGCCCCGGTCATGATGGAGGTCCCAGCCACAGGGAACCATGAGCTCAGTGGTCTTGGAACAGCTCACTAAGTCAGTCCTTCCTTAGCCTGGAAGTCAGTAGTGGAGTCACAAAGCCCATGTGTTTTGCCATCTAGGCCTTCACCTGGTCTGTGGACTTATACCTGTGTGCTTGGTTTACAGGTCCAGTGGTTCTTCAGCCCATGACAGATGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

V K Chaithanya Ponnaluri et al.
Journal of molecular biology, 430(14), 2051-2065 (2018-05-15)
DNA (cytosine-5) methyltransferase 1 (DNMT1) is essential for mammalian development and maintenance of DNA methylation following DNA replication in cells. The DNA methylation process generates S-adenosyl-l-homocysteine, a strong inhibitor of DNMT1. Here we report that S-adenosylhomocysteine hydrolase (SAHH/AHCY), the only
Carolina Magdalen Greco et al.
Science advances, 6(51) (2020-12-18)
Circadian gene expression driven by transcription activators CLOCK and BMAL1 is intimately associated with dynamic chromatin remodeling. However, how cellular metabolism directs circadian chromatin remodeling is virtually unexplored. We report that the S-adenosylhomocysteine (SAH) hydrolyzing enzyme adenosylhomocysteinase (AHCY) cyclically associates
Sae Jeong Park et al.
American journal of cancer research, 5(7), 2127-2138 (2015-09-04)
S-adenosylhomocysteine hydrolase (AHCY) hydrolyzes S-adenosylhomocysteine to adenosine and l-homocysteine, and it is already known that inhibition of AHCY decreased cell proliferation by G2/M arrest in MCF7 cells. However, the previous study has not indicated what mechanism the cell cycle arrest

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique