Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU153761

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGCAGAGGGTGGTTATGTGCTGTACCCTCAGATCGGGGACCGGCTAGACCTGCTCTGCCCCCGGGCCCGGCCTCCTGGCCCTCACTCCTCTCCTAATTATGAGTTCTACAAGCTGTACCTGGTAGGGGGTGCTCAGGGCCGGCGCTGTGAGGCACCCCCTGCCCCAAACCTCCTTCTCACTTGTGATCGCCCAGACCTGGATCTCCGCTTCACCATCAAGTTCCAGGAGTATAGCCCTAATCTCTGGGGCCACGAGTTCCGCTCGCACCACGATTACTACATCATTGCCACATCGGATGGGACCCGGGAGGGCCTGGAGAGCCTGCAGGGAGGTGTGTGCCTAACCAGAGGCATGAAGGTGCTTCTCCGAGTGGGACAAAGTCCCCGAGGAGGGGCTGTCCCCCGAAAACCTGTGTCTGAAATGCCCATGGAAAGAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Judith Rudolph et al.
Frontiers in cellular neuroscience, 8, 185-185 (2014-08-08)
During embryonic development the preoptic area (POA) gives rise to two populations of neurons which are generated at the same time, cortical interneurons and striatal cells. POA-derived cortical interneurons take a superficial path and avoid the developing striatum (Str) when
Amélie Royet et al.
Oncotarget, 8(14), 23750-23759 (2017-04-21)
EphA4, an Ephrins tyrosine kinase receptor, behaves as a dependence receptor (DR) by triggering cell apoptosis in the absence of its ligand Ephrin-B3. DRs act as conditional tumor suppressors, engaging cell death based on ligand availability; this mechanism is bypassed
Hiroko Sugiura et al.
Nature communications, 6, 6842-6842 (2015-04-17)
Rheb is a small GTP-binding protein and its GTPase activity is activated by the complex of Tsc1 and Tsc2 whose mutations cause tuberous sclerosis complex (TSC). We previously reported that cultured TSC neurons showed impaired spine synapse morphogenesis in an

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique