Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU152551

Sigma-Aldrich

MISSION® esiRNA

targeting human LDLR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCACAACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCGTGAACATCTGCCTGGAGTCCCGTCCCTGCCCAGAACCCTTCCTGAGACCTCGCCGGCCTTGTTTTATTCAAAGACAGAGAAGACCAAAGCATTGCCTGCCAGAGCTTTGTTTTATATATTTATTCATCTGGGAGGCAGAACAGGCTTCGGACAGTGCCCATGCAATGGCTTGGGTTGGGATTTTGGTTTCTTCCTTTCCTCGTGAAGGATAAGAGAAACAGGCCCGGGGGGACCAGGATGACACCTCCATTTCTCTCCAGGAAGTTTTGAGTTTCTCTCCACCGTGACACAATCCTCAAACATGGAAGATGAAAGGGGAGGGGATGTCAGGCCCAGAGAAGCAAGTGGCTTTCAACACACAACAGCAGATGGC

Numéro d'accès Ensembl | humain

ENSG00000130164

Numéro d'accès NCBI

NM_000527

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LDLR(3949) , LDLR(3949)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xue-Hai Liang et al.
Nucleic acids research, 45(16), 9528-9546 (2017-09-22)
A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting
E J Gallagher et al.
Oncogene, 36(46), 6462-6471 (2017-08-02)
Obesity is associated with an increase in cancer-specific mortality in women with breast cancer. Elevated cholesterol, particularly low-density lipoprotein cholesterol (LDL-C), is frequently seen in obese women. Here, we aimed to determine the importance of elevated circulating LDL, and LDL
Kentaro Gokita et al.
Molecular therapy. Nucleic acids, 19, 330-338 (2019-12-27)
MicroRNAs (miRNAs) are endogenous small noncoding RNAs that negatively regulate gene expression by interfering with the translation or stability of target transcripts. Some tumor-suppressive miRNAs can concurrently target multiple cancer-promoting genes and may be useful as therapeutic anticancer agents. However
Jinkuk Choi et al.
Science translational medicine, 7(314), 314ra184-314ra184 (2015-11-20)
Apolipoprotein E (ApoE) is an important modifier of Alzheimer's disease (AD) pathogenesis, and its abundance has been linked to the clearance of β-amyloid (Aβ) in the brain. The pathways that control the clearance of ApoE in the brain are incompletely

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique