Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU137641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGAGGCTTCGTTTCGGTTTCGCGGCGGCGGCGGCGTTGTTGGCTGAGGGGACCCGGGACACCTGAATGCCCCCGGCCCCGGCTCCTCCGACGCGATGGGGAAGGTGCTATCCAAAATCTTCGGGAACAAGGAAATGCGGATCCTCATGTTGGGCCTGGACGCGGCCGGCAAGACAACAATCCTGTACAAGTTGAAGCTGGGCCAGTCGGTGACCACCATTCCCACTGTGGGTTTCAACGTGGAGACGGTGACTTACAAAAATGTCAAGTTCAACGTATGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTCTGGCGGCATTACTACACTGGGACCCAAGGTCTCATCTTCGTAGTGGACTGCGCCGACCGCGACCGCATCGATGAGGCTCGCCAGGAGCTGCACCGCATTATCAATGACCGGGAGATGAG

Numéro d'accès Ensembl | humain

ENSG00000165527

Numéro d'accès NCBI

NM_001663

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ARF6(382) , ARF6(382)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yujie Zhang et al.
Oncotarget, 6(9), 7244-7261 (2015-03-18)
Wnt5a, a ligand for activating the non-canonical Wnt signaling pathway, is commonly associated with Epithelial-to-mesenchymal transition (EMT) in cancer cell metastasis. Here, we show that downregulation of Wnt5a mRNA and protein by EGF is necessary for EGF-induced EMT in gastric
Yueh-Chien Lin et al.
Scientific reports, 7(1), 11431-11431 (2017-09-14)
The small GTPase Arf6 plays pivotal roles in a wide variety of cellular events such as endocytosis, exocytosis, and actin cytoskeleton reorganization. However, the physiological functions of Arf6 at the whole animal level have not yet been thoroughly understood. Here
Vahitha B Abdul-Salam et al.
Circulation research, 124(1), 52-65 (2018-12-26)
Increased expression of CLIC4 (chloride intracellular channel 4) is a feature of endothelial dysfunction in pulmonary arterial hypertension, but its role in disease pathology is not fully understood. To identify CLIC4 effectors and evaluate strategies targeting CLIC4 signaling in pulmonary
Mohamed Bourmoum et al.
Journal of cell science, 131(11) (2018-05-05)
Sister chromatid cohesion, facilitated by the cohesin protein complex, is crucial for the establishment of stable bipolar attachments of chromosomes to the spindle microtubules and their faithful segregation. Here, we demonstrate that the GTPase ARF6 prevents the premature loss of
Jamie S Lin et al.
PloS one, 12(9), e0184575-e0184575 (2017-09-08)
ADP-ribosylation factor 6 (ARF6) is a small GTPase necessary for regulating cellular structure, motility, and vesicle trafficking. In several cellular systems, ARF6 was shown to regulate actin dynamics in coordination with Rac1, a Rho small GTPase. We examined the function
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique