Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU136211

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGAGGGCACATGCAGTAGATATTAATGGAAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGACAACAGACCTGAGTTCTTACACCAGGTTTGGAATGGGACAGTTCCTGAGGGATCAAAGCCTGGAACATATGTGATGACCGTAACAGCAATTGATGCTGACGATCCCAATGCCCTCAATGGGATGTTGAGGTACAGAATCGTGTCTCAGGCTCCAAGCACCCCTTCACCCAACATGTTTACAATCAACAATGAGACTGGTGACATCATCACAGTGGCAGCTGGACTTGATCGAGAAAAAGTGCAACAGTATACGTTAATAATTCAAGCTACAGACATGGAAGGCAATCCCACATATGGCCTTTCAAACACAGCCACGGCCGTCATCACAGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACGTTTTATGGTGAAGTTCCTGAGAACAGGGTAGACATCATAGTAGCTAATCTAACTGTGACCGATAAGGATCAACCCCATACACCA

Numéro d'accès Ensembl | humain

ENSG00000170558

Numéro d'accès NCBI

NM_001792

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CDH2(1000) , CDH2(1000)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hsien-Ming Wu et al.
Oncotarget, 8(3), 4410-4421 (2016-12-30)
More than 25% of patients diagnosed with endometrial carcinoma have invasive primary cancer accompanied by metastases. Growth hormone-releasing hormone (GHRH) plays an important role in reproduction. Here, we examined the effect of a GHRH antagonist on the motility of endometrial
Bo Xu et al.
Nature biotechnology (2018-11-27)
The efficacy of oncolytic herpes simplex virus (oHSV) is limited by rapid viral clearance by innate immune effector cells and poor intratumoral viral spread. We combine two approaches to overcome these barriers: inhibition of natural killer (NK) cells and enhancement
Ciqing Yang et al.
Histochemistry and cell biology, 151(3), 239-248 (2018-09-27)
N-cadherin, a member of the cadherin family, plays an important role in neural development. In addition, N-cadherin has been reported to be crucial in neuronal migration, axonal outgrowth, and axonal path-finding. However, the mechanism underlying the effects of N-cadherin in
Srikanth R Polusani et al.
Journal of cell science, 129(23), 4399-4410 (2016-11-02)
Gap junction proteins (connexins) have crucial effects on cell motility in many systems, from migration of neural crest cells to promotion of metastatic invasiveness. Here, we show that expression of Cx26 (also known as GJB2) in HeLa cells specifically enhances
Ciqing Yang et al.
Journal of molecular histology, 47(6), 541-554 (2016-09-22)
N-cadherin is a calcium-sensitive cell adhesion molecule that plays an important role in the formation of the neural circuit and the development of the nervous system. In the present study, we investigated the function of N-cadherin in cell-cell connection in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique