Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU135581

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTTCCCTCCTGTTCTCTGGTTATAGCTGGTCCCAGGTCAGCGTGGGAGGCACCTTTGGGTTCCCAGTGCCCAGCACTTTGTAGTCTCATCCCAGATTACTAACCCTTCCTGATCCTGGAGAGGCAGGGATAGTAAATAAATTGCTCTTCCTACCCCATCCCCCATCCCCTGACAAAAAGTGACGGCAGCCGTACTGAGTCTGTAAGGCCCAAAGTGGGTACAGACAGCCTGGGCTGGTAAAAGTAGGTCCTTATTTACAAGGCTGCGTTAAAGTTGTACTAGGCAAACACACTGATGTAGGAAGCACGAGGAAAGGA

Numéro d'accès Ensembl | humain

ENSG00000020633

Numéro d'accès NCBI

NM_001031680

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RUNX3(864) , RUNX3(864)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bufeng Zhuang et al.
Molecular medicine reports, 19(5), 3933-3940 (2019-03-01)
Dysregulated microRNAs (miRNAs/miRs) directly modulate the biological functions of non‑small cell lung cancer (NSCLC) cells and contribute to the initiation and progression of NSCLC; however, the specific roles and underlying mechanisms of the dysregulated miRNAs in NSCLC require further investigation.
J Justin Milner et al.
Nature, 552(7684), 253-257 (2017-12-07)
Tissue-resident memory CD8
Jikui Sun et al.
Oncotarget, 8(67), 110785-110796 (2018-01-18)
Accumulating data demonstrates that the network dysregulation of microRNA-medicated target genes is involved in glioma. We have previously found miR-19a/b overexpression in glioma cell lines and specimens with various tumour grades. However, there was no report on the function and
Haiping Yang et al.
International journal of molecular medicine, 40(5), 1466-1476 (2017-09-28)
Bronchopulmonary dysplasia (BPD) is a major challenge for premature infants; however, the underlying mechanisms remain unclear. We previously reported that epithelial-mesenchymal transition (EMT) in alveolar type II (AT2) epithelial cells influences the normal alveolar development process. In this study, we wished to examine whether
Lin Shi et al.
Cell stress & chaperones, 25(5), 793-802 (2020-07-19)
Lung toxicity is the main cause of the death from methamphetamine (MA) abuse, but its mechanism has remained unclear. The purpose of our study was to investigate if MA can induce epithelial-to-mesenchymal transition (EMT) and if RUNX3 is involved in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique