Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU131051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDX58

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCTGGAGGAACTGGAGCAAGTTGTTTATAAGCCCCAGAAGTTTTTCAGGAAAGTGGAATCACGGATTAGCGACAAATTTAAATACATCATAGCTCAGCTGATGAGGGACACAGAGAGTCTGGCAAAGAGAATCTGCAAAGACCTCGAAAACTTATCTCAAATTCAAAATAGGGAATTTGGAACACAGAAATATGAACAATGGATTGTTACAGTTCAGAAAGCATGCATGGTGTTCCAGATGCCAGACAAAGATGAAGAGAGCAGGATTTGTAAAGCCCTGTTTTTATACACTTCACATTTGCGGAAATATAATGATGCCCTCATTATCAGTGAGCATGCACGAATGAAAGATGCTCTGGATTACTTGAAAGACTTCTTCAGCAATGTCCGAGCAGCAGGATTCGATGAGATTGAGCAAGATCTTACTCAGAGATTTGAAGAAAAGCTGCAGGAACTAGAAAGTGTTTCCAGGGATCCC

Numéro d'accès Ensembl | humain

ENSG00000107201

Numéro d'accès NCBI

NM_014314

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DDX58(23586) , DDX58(23586)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ting He et al.
Life sciences, 231, 116570-116570 (2019-06-18)
Systemic inflammation is a main hallmark of chronic kidney disease (CKD), but the underlying mechanisms of pathogenesis of CKD-associated systemic inflammation is unclear. Current study was designed to investigate the relationship between indoxyl sulphate (IS) and CKD-associated systemic inflammation along
Ming Zhong et al.
BMC cancer, 19(1), 439-439 (2019-05-16)
Dendritic cells (DCs) alter their role from being immunostimulatory to immunosuppressive at advanced stages of tumor progression, but the influence of cancer stem cells (CSCs) and their secreted factors on generation and phenotypic change of DCs is unknown. Retinoic acid-inducible
Darong Yang et al.
PloS one, 9(4), e94501-e94501 (2014-04-15)
The interaction between hepatitis C virus (HCV) and human hepatic innate antiviral responses is unclear. The aim of this study was to examine how human hepatocytes respond to HCV infection. An infectious HCV isolate, JFH1, was used to infect a
Simin Li et al.
Cancer science, 108(12), 2333-2341 (2017-09-26)
We have already reported that the inactivated Sendai virus (hemagglutinating virus of Japan; HVJ) envelope (HVJ-E) has multiple anticancer effects, including induction of cancer-selective cell death and activation of anticancer immunity. The HVJ-E stimulates dendritic cells to produce cytokines and
Luciano Castiello et al.
Cancer immunology, immunotherapy : CII, 68(9), 1479-1492 (2019-08-30)
RIG-I is a cytosolic RNA sensor that recognizes short 5' triphosphate RNA, commonly generated during virus infection. Upon activation, RIG-I initiates antiviral immunity, and in some circumstances, induces cell death. Because of this dual capacity, RIG-I has emerged as a
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique