Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU130891

Sigma-Aldrich

MISSION® esiRNA

targeting human TUG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA

Numéro d'accès Ensembl | humain

ENSG00000182457

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TUG1(55000)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kewei Ren et al.
Oncology research, 25(5), 789-798 (2016-12-17)
Long noncoding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) is involved in the development and carcinogenesis of various tumors, suggesting the diagnostic potential of TUG1 in these cancers. However, the exact role of TUG1 and its underlying mechanism in gastric cancer
Ying Ai et al.
International immunopharmacology, 86, 106703-106703 (2020-07-01)
Intrauterine adhesion (IUA) is one of the most common reproductive system diseases in women worldwide. The role of lncRNAs in multiple diseases has been confirmed, but the role and mechanism of lncRNA taurine upregulated gene 1 (TUG1) in the progression
T Xu et al.
European review for medical and pharmacological sciences, 23(11), 4698-4705 (2019-06-19)
To explore the correlation between plasma level of lncRNA TUG1 with PSA level, Gleason grading and tumor node metastasis (TNM) stage of prostate cancer (PCa) patients. This study aims to evaluate the potential diagnostic and prognostic values of TUG1 in
Xiaodi Liu et al.
Journal of cellular biochemistry (2019-03-06)
This study intended to investigate the potential molecular mechanism of long noncoding RNA (lncRNA) taurine upregulated gene 1 (TUG1) in the development of sepsis-associated acute kidney injury (AKI). The expression of TUG1 in the serum from patients with sepsis resulted
Pan Wang et al.
Journal of experimental & clinical cancer research : CR, 39(1), 7-7 (2020-01-11)
Long noncoding RNAs (lncRNAs) are involved in the progression of various cancers and affect the response to radiotherapy. This study focused on clarifying the underlying mechanism by which lncTUG1 affects the radiosensitivity of esophageal squamous cell carcinoma (ESCC). lncTUG1, miR-144-3p
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique