Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU130651

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFAF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTGTGAGCCGTCAGTGAAACACTTAGAGCAGTTTCTGGCACATGGTAGAATTGGGCTATTTGCTGAAGCTTCTTGGTGGCCCTTGCTAGCCCAGGAAGAAACTTACATTTTGATTTTTTTGTACCATGGCTTTGGTTCACAAATTGCTGCGTGGTACTTATTTTCTCAGAAAATTCTCTAAGCCAACTTCTGCCTTGTATCCATTTTTGGGTATTCGCTTTGCAGAGTATTCCAGTAGTCTTCAGAAACCAGTGGCTTCTCCTGGCAAAGCCTCCTCACAGAGGAAGACTGAAGGGGATTTGCAAGGAGATCACCAGAAAGAAGTTGCTTTGGATATAACTTCTTCTGAGGAGAAGCCTGATGTTAGTTTCGATAAAGCAATTAGAGATGAAGCAATATACCATTTTAGGCTTTTGAAGGATGAAATTGTGGATCATTGGAGAGGACCGGAAGGCCACCCTCTGCATGAGGTCTTGCTGGAACAAGC

Numéro d'accès Ensembl | humain

ENSG00000137806

Numéro d'accès NCBI

NM_016013

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NDUFAF1(51103) , NDUFAF1(51103)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kelly Quesnelle et al.
Nitric oxide : biology and chemistry, 104-105, 36-43 (2020-09-07)
It is well established that myoglobin supports mitochondrial respiration through the storage and transport of oxygen as well as through the scavenging of nitric oxide. However, during ischemia/reperfusion (I/R), myoglobin and mitochondria both propagate myocardial injury through the production of
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique