Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU129271

Sigma-Aldrich

MISSION® esiRNA

targeting human DDX5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGC

Numéro d'accès Ensembl | humain

ENSG00000108654

Numéro d'accès NCBI

NM_004396

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DDX5(1655) , DDX5(1655)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hao Zhang et al.
Hepatology (Baltimore, Md.), 69(3), 1046-1063 (2018-10-04)
In hepatocellular carcinoma (HCC), dysregulated expression of DDX5 (DEAD box protein 5) and impaired autophagy have been reported separately. However, the relationship between them has not been explored. Here we present evidence to show that, by interacting with autophagic receptor
Zheng Xing et al.
RNA (New York, N.Y.), 23(7), 1125-1138 (2017-04-16)
DEAD-box proteins are a class of nonprocessive RNA helicases that dynamically modulate the structure of RNA and ribonucleoprotein complexes (RNPs). However, the precise roles of individual members are not well understood. Work from our laboratory revealed that the DEAD-box protein
Nazia Abbasi et al.
Life science alliance, 3(10) (2020-08-21)
Tumorigenesis in different segments of the intestinal tract involves tissue-specific oncogenic drivers. In the colon, complement component 3 (C3) activation is a major contributor to inflammation and malignancies. By contrast, tumorigenesis in the small intestine involves fatty acid-binding protein 1
Yeon J Lee et al.
Genes & development, 32(15-16), 1060-1074 (2018-07-26)
Alternative premessenger RNA (pre-mRNA) splicing is a post-transcriptional mechanism for controlling gene expression. Splicing patterns are determined by both RNA-binding proteins and nuclear pre-mRNA structure. Here, we analyzed pre-mRNA splicing patterns, RNA-binding sites, and RNA structures near these binding sites
Peter Hoch-Kraft et al.
Journal of cell science, 131(9) (2018-04-07)
In the central nervous system, oligodendroglial expression of myelin basic protein (MBP) is crucial for the assembly and structure of the myelin sheath. MBP synthesis is tightly regulated in space and time, particularly at the post-transcriptional level. We have identified
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique