Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU124311

Sigma-Aldrich

MISSION® esiRNA

targeting human EGR2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACTGATTTGGGGGACATTGTACAGTGAGTGAAGTATAGCCTTTATGCCACACTCTGTGGCCCTAAAATGGTGAATCAGAGCATATCTAGTTGTCTCAACCCTTGAAGCAATATGTATTATAAACTCAGAGAACAGAAGTGCAATGTGATGGGAGGAACATAGCAATATCTGCTCCTTTTCGAGTTGTTTGAGAAATGTAGGCTATTTTTTCAGTGTATATCCACTCAGATTTTGTGTATTTTTGATGTACACTGTTCTCTAAATTCTGAATCTTTGGGAAAAAATGTAAAGCATTTATGATCTCAGAGGTTAACTTATTTAAGGGGGATGTACATATATTCTCTGAAACTAGGATGCATGCAATTGTGTTGGAAGTGTCCTTGGTGCCTTGTGTGATGT

Numéro d'accès Ensembl | humain

ENSG00000122877

Numéro d'accès NCBI

NM_000399
NM_001136177

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EGR2(1959) , EGR2(1959)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

C-S Zang et al.
European review for medical and pharmacological sciences, 24(9), 4890-4900 (2020-05-21)
Various microRNAs (miRNAs) have been reported to be involved in the pathogenesis and development of human cancers, including papillary thyroid carcinoma (PTC). However, the role of miR-224-5p in PTC progression remains unclear. Therefore, the purpose of this study is to
Qingtao Meng et al.
Oncotarget, 8(49), 86217-86226 (2017-11-22)
Cervical cancer is the second leading cause of mortality among women. Impairment of the base excision repair (BER) pathway is one of the major causes of the initiation and progression of cervical cancer. However, whether the polymorphisms of the BER
Xuzhi Liu et al.
Acta biochimica et biophysica Sinica, 47(6), 431-440 (2015-05-04)
Non-small-cell lung cancer (NSCLC) is one of the most common lung cancers, and microRNAs (miRNAs) have been reported to play essential roles in NSCLC. Recent studies have indicated that miR-330-3p expression is up-regulated in NSCLC samples and in tissues of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique