Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU122051

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

M Bam et al.
Translational psychiatry, 7(8), e1222-e1222 (2017-08-30)
Chronic inflammation is a characteristic of post-traumatic stress disorder (PTSD). The initiation of inflammation and molecules involved are not yet clearly understood. Here, we provide compelling evidence that the inflammation seen in PTSD may result from the dysregulated miRNA processing
Chengyang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 743-756 (2017-09-28)
To evaluate the effect of Liuweibuqi capsules on chronic obstructive pulmonary disease (COPD) through the JAK/STAT pathway. Lung function was measured with a spirometer. Changes in lung histology were observed using H&E staining. Cigarette smoke extract combined with lipopolysaccharide (CSE+LPS)
Young Yun Jung et al.
Frontiers in pharmacology, 9, 531-531 (2018-06-15)
Because of the essential role of signal transducer and activator of transcription 3 (STAT3) in proliferation, anti-apoptosis, and chemoresistance of multiple myeloma (MM), we investigated whether icariin, a prenylated flavonol glycoside, inhibits both constitutive and inducible STAT3 activation in human
Thijs S Stutvoet et al.
The Journal of pathology, 249(1), 52-64 (2019-04-12)
Immune checkpoint inhibitors targeting programmed cell death protein 1 (PD-1) and programmed death-ligand 1 (PD-L1) have improved the survival of patients with non-small cell lung cancer (NSCLC). Still, many patients do not respond to these inhibitors. PD-L1 (CD274) expression, one
Yu Dong et al.
Oncotarget, 8(67), 111728-111741 (2018-01-18)
Glioma stem cell (GSC)-targeted therapy is expected to be one of the most innovative approaches to treat patients with glioblastoma (GBM). A number of the drugs that restrain the signaling pathway essential for GSC maintenance have been under clinical trials.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique