Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU119911

Sigma-Aldrich

MISSION® esiRNA

targeting human DAPK3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCATGCTGCTGGACAAGAACGTGCCCAACCCACGAATCAAGCTCATCGACTTCGGCATCGCGCACAAGATCGAGGCGGGGAACGAGTTCAAGAACATCTTCGGCACCCCGGAGTTTGTGGCCCCAGAGATTGTGAACTATGAGCCGCTGGGCCTGGAGGCGGACATGTGGAGCATCGGTGTCATCACCTATATCCTCCTGAGCGGTGCATCCCCGTTCCTGGGCGAGACCAAGCAGGAGACGCTCACCAACATCTCAGCCGTGAACTACGACTTCGACGAGGAGTACTTCAGCAACACCAGCGAGCTGGCCAAGGACTTCATTCGCCGGCTGCTCGTCAAAGATCCCAAGCGGAGAATGACCATTGCCCAGAGCCTGGAACATTCCTGGATTAAGGCGATCCGGCGGCGGAACGTGCGTGGTGAGGACAGCGGCCGCAAGCCCGAGCGGCGGCGCCTGAAGACCACGCGTCTGAAGGAGTACACCATCAAGTCGCACTCCAGCTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ke-Xue Li et al.
European journal of pharmacology, 852, 90-98 (2019-03-10)
Vascular calcification (VC) is a critical feature of chronic kidney disease (CKD), diabetes, hypertension, and atherosclerosis. Death-associated protein kinase 3 (DAPK3) is involved in vascular remodeling in hypertension. However, it remains to be clarified whether DAPK3 controls vascular smooth muscle
Jing-Ti Deng et al.
PloS one, 14(12), e0226406-e0226406 (2019-12-14)
Myosin regulatory light chain (LC20) phosphorylation plays an important role in vascular smooth muscle contraction and cell migration. Ca2+/calmodulin-dependent myosin light chain kinase (MLCK) phosphorylates LC20 (its only known substrate) exclusively at S19. Rho-associated kinase (ROCK) and zipper-interacting protein kinase

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique