Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU119651

Sigma-Aldrich

MISSION® esiRNA

targeting human ID2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCAGAACAAGAAGGTGAGCAAGATGGAAATCCTGCAGCACGTCATCGACTACATCTTGGACCTGCAGATCGCCCTGGACTCGCATCCCACTATTGTCAGCCTGCATCACCAGAGACCCGGGCAGAACCAGGCGTCCAGGACGCCGCTGACCACCCTCAACACGGATATCAGCATCCTGTCCTTGCAGGCTTCTGAATTCCCTTCTGAGTTAATGTCAAATGACAGCAAAGCACTGTGTGGCTGAATAAGCGGTGTTCATGATTTCTTTTATTCTTTGCACAACAACAACAACAACAAATTCACGGAATCTTTTAAGTGCTGAACTTATTTTTCAACCATTTCACAAGGAGGACAAGTTGAATGGACCTTTTTAAAAAGAAAAAAAAAATGGAAGGAAAACTAAGAATGATCATCTTCCCAGGGTGTTCT

Numéro d'accès Ensembl | humain

ENSG00000115738

Numéro d'accès NCBI

NM_002166

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ID2(3398) , ID2(3398)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yin Liu et al.
Breast cancer research and treatment, 175(1), 77-90 (2019-02-07)
Ductal carcinoma in situ (DCIS) is a non-invasive form of breast cancer which could progress to or recur as invasive breast cancer. The underlying molecular mechanism of DCIS progression is yet poorly understood, and appropriate biomarkers to distinguish benign form
Yilin Pan et al.
Molecular immunology, 128, 106-115 (2020-10-31)
The aims of the present study were to investigate the signaling mechanisms for sphingosine-1-phosphate (S1P)-induced airway smooth muscle cells (ASMCs) proliferation and to explore the effect of activation of adenosine monophosphate-activated protein kinase (AMPK) on S1P-induced ASMCs proliferation and its
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique