Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU116361

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCCCAGAGCATCATTGACGCAAATGATACTTTGAAGGACTTGACGAAAGTAACATTGGGAGACAATGTGAAATACTACAATTTGGCCAGGATAAAGTGGGACCCCTCTGATCCTCAAATAATATCTGAAGGTCTTTATGCAATTGCTGTAGTTTTAAGTTTCTCTAGGATAGCTTATATTTTACCAGCAAATGAAAGCTTTGGACCTCTGCAGATATCACTTGGAAGAACAGTCAAAGACATCTTCAAGTTCATGGTCATATTCATTATGGTGTTTGTGGCCTTTATGATTGGAATGTTCAATCTCTACTCCTACTACATTGGTGCAAAACAAAATGAAGCCTTCACAACAGTTGAAGAGAGTTTTAAGACACTGTTCTGGGCTATATTTGGACTTTCTGAAGTGAAATCAGTGGTCATCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Liang Wen et al.
Scientific reports, 6, 23269-23269 (2016-03-25)
Hepatocellular carcinoma (HCC) is notoriously refractory to chemotherapy because of its tendency to develop multi-drug resistance (MDR), whose various underlying mechanisms make it difficult to target. The calcium signalling pathway is associated with many cellular biological activities, and is also
Navin K Kapur et al.
Journal of the American Heart Association, 3(4) (2014-07-13)
Right ventricular (RV) failure is a major cause of mortality worldwide and is often a consequence of RV pressure overload (RVPO). Endoglin is a coreceptor for the profibrogenic cytokine, transforming growth factor beta 1 (TGF-β1). TGF-β1 signaling by the canonical
Hitesh Soni et al.
Scientific reports, 6, 29041-29041 (2016-07-08)
Glomerular mesangial cell (GMC) proliferation and death are involved in the pathogenesis of glomerular disorders. The mechanisms that control GMC survival are poorly understood, but may include signal transduction pathways that are modulated by changes in intracellular Ca(2+) ([Ca(2+)]i) concentration.
Haiyang Tang et al.
American journal of physiology. Lung cellular and molecular physiology, 310(9), L846-L859 (2016-03-13)
An increase in cytosolic free Ca(2+) concentration ([Ca(2+)]cyt) in pulmonary arterial smooth muscle cells (PASMC) is a major trigger for pulmonary vasoconstriction and a critical stimulation for PASMC proliferation and migration. Previously, we demonstrated that expression and function of calcium
Kazuo Murakami et al.
Fundamental & clinical pharmacology, 31(4), 383-391 (2017-01-21)
We reported that coronary spasm was induced in the transgenic mice with the increased phospholipase C (PLC)-δ1 activity. We investigated the effect of enhanced PLC-δ1 on Ca

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique