Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU113611

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCCTTGTACTCAACTAGTGCAAACCTGCCCGTCATGGGCCATGAGAAGTTCCCCAGCGACTTGGACCTGGACATGTTCAATGGGAGCTTGGAATGTGACATGGAGTCCATTATCCGTAGTGAACTCATGGATGCTGATGGGTTGGATTTTAACTTTGATTCCCTCATCTCCACACAGAATGTTGTTGGTTTGAACGTGGGGAACTTCACTGGTGCTAAGCAGGCCTCATCTCAGAGCTGGGTGCCAGGCTGAAGGATCACTGAGGAAGGGGAAGTGGGCAAAGCAGACCCTCAAACTGACACAAGACCTACAGAGAAAACCCTTTGCCAAATCTGCTCTCAGCAAGTGGACAGTGATACCGTTTACAGCTTAACACCTTTGTGAATCCCACGCCATTTTCCTAACCCAGCAGAGACTGTTAATGGCCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ning Liu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(7), 603-610 (2017-04-13)
Fibroblast-like synoviocytes (FLS) play an essential role in the pathogenesis of chronic inflammatory diseases, such as rheumatoid arthritis. Paeonol (Pae) is a phenolic compound found in many traditional Chinese medicine remedies. However, the effects of Pae on TNF-α-stimulated FLS and
M Kumazoe et al.
Oncogene, 36(19), 2643-2654 (2016-11-29)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal types of cancer and the 5-year survival rate is only 5%. Several studies have suggested that cancer stem cells (CSCs) are thought to be involved in recurrence and metastasis and
Yanqiu Wang et al.
Biochemical and biophysical research communications, 524(3), 756-763 (2020-02-10)
Intervertebral disc degeneration (IDD) is typically accompanied by a reduced nutrient supply, which is thought to be a contributor to the apoptosis of nucleus pulposus cells (NPCs). Here, we explored whether Forkhead box O3 (FOXO3), a key transcription factor involved
Jangsoon Lee et al.
Breast cancer research and treatment, 146(2), 259-272 (2014-06-12)
Although there are effective HER2-targeted agents, novel combination strategies in HER2-overexpressing breast cancers are needed for patients whose tumors develop drug resistance. To develop new therapeutic strategy, we investigated the combinational effect of entinostat, an oral isoform-selective histone deacetylase type
Fei Wang et al.
Folia histochemica et cytobiologica, 58(1), 1-8 (2020-02-01)
Osteoarthritis (OA) is the most common degenerative disease in middle-aged and elderly individuals that causes joint deformity and limb disability. Accumulating evidence has suggested that the pathogenesis of OA has been related to various mechanisms such as apoptosis, inflammation, oxidative

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique