Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU107781

Sigma-Aldrich

MISSION® esiRNA

targeting human FFAR3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTACAACGTGTCCCATGTCGTGGGCTATATCTGCGGTGAAAGCCCGGCGTGGAGGATCTACGTGACGCTTCTCAGCACCCTGAACTCCTGTGTCGACCCCTTTGTCTACTACTTCTCCTCCTCCGGGTTCCAAGCCGACTTTCATGAGCTGCTGAGGAGGTTGTGTGGGCTCTGGGGCCAGTGGCAGCAGGAGAGCAGCATGGAGCTGAAGGAGCAGAAGGGAGGGGAGGAGCAGAGAGCGGACCGACCAGCTGAAAGAAAGACCAGTGAACACTCACAGGGCTGTGGAACTGGTGGCCAGGTGGCCTGTGCTGAAAGCTAGGTCCTCCGGGGGAGGAGGGTGTAGCTGGCATGTCATCCTCAGGGCGCTTCCTCGCTCACGCCAGGAGGGACTTGGAGTGGCGAGCTGGGGCCCGATGGGGCTTGGGGGCAGAGTAGACATCTAGCCTCCCTAAGGGTATGCGCGCTAAAGCCCAGCTCTCGATCTCACCTCC

Numéro d'accès Ensembl | humain

ENSG00000185897

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FFAR3(2865) , FFAR3(2865)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hope Eveline Carter Moylan et al.
Molecular human reproduction, 26(6), 452-468 (2020-04-03)
Spontaneous preterm birth is a global health issue affecting up to 20% of pregnancies and leaves a legacy of neurodevelopmental complications. Inflammation has been implicated in a significant proportion of preterm births, where pro-inflammatory insults trigger production of additional pro-inflammatory
Mamiko Kobayashi et al.
Biochemical and biophysical research communications, 486(2), 499-505 (2017-03-23)
Short-chain fatty acids (SCFAs), such as acetate, propionate, and butyrate, are produced predominantly by gut microbiota fermentation of dietary fiber. SCFAs are newly identified as endogenous ligands of two orphan G protein-coupled receptors, GPR41 and GPR43, which have the potential
Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Zhenhua Zhou et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 41(2), 267-281 (2020-03-11)
Sodium butyrate, a short-chain fatty acid, is predominantly produced by gut microbiota fermentation of dietary fiber and serves as an important neuromodulator in the central nervous system. Recent experimental evidence has suggested that sodium butyrate may be an endogenous ligand

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique