Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU099041

Sigma-Aldrich

MISSION® esiRNA

targeting human CBS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC

Numéro d'accès Ensembl | humain

ENSG00000160200

Numéro d'accès NCBI

NM_000071

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CBS(102724560) , CBS(875)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Huina Jia et al.
Oncology reports, 37(5), 3001-3009 (2017-04-26)
Hydrogen sulfide (H2S), the third gasotransmitter, plays important roles in cancer biological processes. As endogenous H2S exerts pro-cancer functions, inhibition of its production in cancer cells may provide a new cancer treatment strategy and be achieved via regulation of the function
Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Nozomu Takahashi et al.
Nucleic acids research, 45(1), 435-445 (2016-08-29)
The 2-methylthio (ms
Xiangning Yuan et al.
Kidney & blood pressure research, 42(3), 428-443 (2017-07-28)
Renal tubulointerstitial fibrosis (TIF) is the common pathway of progressive chronic kidney disease. Inflammation has been widely accepted as the major driving force of TIF. Cystathionine β-synthase (CBS) is the first and rate-limiting enzyme in the transsulfuration pathway. CBS is
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique