Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU097831

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGACCCAATACTCGGAGACTGACTGTTAGCACATGGCTCCTTCGTCAGGGCCTCATTGACACCAGCCTGACGGCATCTGTGGCCAACTTACTGGCTATTGCAATCGAGAGGCACATTACGGTTTTCCGCATGCAGCTCCACACACGGATGAGCAACCGGCGGGTAGTGGTGGTCATTGTGGTCATCTGGACTATGGCCATCGTTATGGGTGCTATACCCAGTGTGGGCTGGAACTGTATCTGTGATATTGAAAATTGTTCCAACATGGCACCCCTCTACAG

Numéro d'accès Ensembl | humain

ENSG00000198121

Numéro d'accès NCBI

NM_001401

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LPAR1(1902) , LPAR1(1902)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Songbai Lin et al.
The American journal of pathology, 188(2), 353-366 (2017-11-13)
Intestinal epithelial cells form a barrier that is critical in protecting the host from the hostile luminal environment. Previously, we showed that lysophosphatidic acid (LPA) receptor 1 regulates proliferation of intestinal epithelial cells, such that the absence of LPA1 mitigates
Hui Ying Li et al.
Kidney international, 91(6), 1362-1373 (2017-01-24)
Lysophosphatidic acid (LPA) is known to regulate various biological responses by binding to LPA receptors. The serum level of LPA is elevated in diabetes, but the involvement of LPA in the development of diabetes and its complications remains unknown. Therefore
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.
Debashish Sahay et al.
Oncotarget, 6(24), 20604-20620 (2015-06-23)
Lysophosphatidic acid (LPA) is a bioactive lipid promoting cancer metastasis. LPA activates a series of six G protein-coupled receptors (LPA1-6). While blockage of LPA1in vivo inhibits breast carcinoma metastasis, down-stream genes mediating LPA-induced metastasis have not been yet identified. Herein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique