Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU095161

Sigma-Aldrich

MISSION® esiRNA

targeting human NCAM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAAGATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGAAGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACACAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTACCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAATCCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yongguang Yang et al.
BMC cell biology, 11, 78-78 (2010-10-20)
The proliferation and final density of Sertoli cells in the testis are regulated by hormones and local factors. Glial cell line-derived neurotrophic factor (GDNF), a distantly related member of the transforming growth factor-β superfamily, and its receptor subunits GDNF family
Natacha Coppieters et al.
Brain research, 1710, 199-208 (2018-12-26)
The neural cell adhesion molecule (NCAM) is a transmembrane protein involved in major cellular processes. The addition of polysialic acid (PSA), a post-translational modification (PTM) almost exclusively carried by NCAM, alters NCAM properties and functions and is therefore tightly regulated.
Chunlei Yu et al.
Toxicology mechanisms and methods, 26(9), 635-643 (2016-11-08)
Curcuma phaeocaulis Val. is a Chinese medicinal herb that is contraindicated during pregnancy for over a thousand years in China. The aims of the present study were to evaluate the effect of curcumol (one of the major components of C.
Mizuki Sumida et al.
The Journal of biological chemistry, 290(21), 13202-13214 (2015-03-10)
As acidic glycocalyx on primary mouse microglial cells and a mouse microglial cell line Ra2, expression of polysialic acid (polySia/PSA), a polymer of the sialic acid Neu5Ac (N-acetylneuraminic acid), was demonstrated. PolySia is known to modulate cell adhesion, migration, and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique