Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU093651

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTGATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGACTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATTTGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTGATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACTATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCCGTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAAAGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yue Zhang et al.
Journal of molecular cell biology, 11(9), 761-769 (2018-12-12)
X chromosome inactivation and genomic imprinting are two classic epigenetic regulatory processes that cause mono-allelic gene expression. In female mammals, mono-allelic expression of the long non-coding RNA gene X-inactive specific transcript (XIST) is essential for initiation of X chromosome inactivation
Wendi Shuai et al.
Cancer letters, 422, 56-69 (2018-02-20)
Suppressor of variegation 3-9 homolog 2 (SUV39H2) is a member of the SUV39H subfamily of lysine methyltransferases. Its role in colorectal cancer (CRC) proliferation and metastasis has remained unexplored. Here, we determined that SUV39H2 was upregulated in CRC tissues compared
Emily B Askew et al.
Molecular and cellular endocrinology, 443, 42-51 (2017-01-04)
Androgen receptor (AR) transcriptional activity depends on interactions between the AR NH
Oriane Mauger et al.
Nucleic acids research, 43(3), 1869-1882 (2015-01-22)
Alternative splicing is the main source of proteome diversity. Here, we have investigated how alternative splicing affects the function of two human histone methyltransferases (HMTase): G9A and SUV39H2. We show that exon 10 in G9A and exon 3 in SUV39H2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique