Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU092971

Sigma-Aldrich

MISSION® esiRNA

targeting human CD151

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAGGCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCACAGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAGCTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGGAGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTCACGTGCTGCCTGTAC

Numéro d'accès Ensembl | humain

ENSG00000177697

Numéro d'accès NCBI

NM_004357

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CD151(977) , CD151(977)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Laura A Fast et al.
International journal of molecular sciences, 19(10) (2018-10-04)
Tetraspanins are suggested to regulate the composition of cell membrane components and control intracellular transport, which leaves them vulnerable to utilization by pathogens such as human papillomaviruses (HPV) and cytomegaloviruses (HCMV) to facilitate host cell entry and subsequent infection. In
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 139(1), 82-92 (2016-05-29)
Airway smooth muscle (ASM) contraction underpins airway constriction; however, underlying mechanisms for airway hyperresponsiveness (AHR) remain incompletely defined. CD151, a 4-transmembrane glycoprotein that associates with laminin-binding integrins, is highly expressed in the human lung. The role of CD151 in ASM
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 141(5), 1799-1817 (2017-12-24)
Despite advances in our understanding of the mechanisms of influenza A virus (IAV) infection, the crucial virus-host interactions during the viral replication cycle still remain incomplete. Tetraspanin CD151 is highly expressed in the human respiratory tract, but its pathological role in
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Jérôme Finke et al.
Scientific reports, 10(1), 5356-5356 (2020-03-27)
During cell invasion, human papillomaviruses use large CD151 patches on the cell surface. Here, we studied whether these patches are defined architectures with features for virus binding and/or internalization. Super-resolution microscopy reveals that the patches are assemblies of closely associated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique