Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU092311

Sigma-Aldrich

MISSION® esiRNA

targeting human PLOD2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTATCCGGGAGTTCATTGCACCAGTTACACTGAAGGTCTTTGCAGGCTATTATACGAAGGGATTTGCACTACTGAATTTTGTAGTAAAATACTCCCCTGAACGACAGCGTTCTCTTCGTCCTCATCATGATGCTTCTACATTTACCATAAACATTGCACTTAATAACGTGGGAGAAGACTTTCAGGGAGGTGGTTGCAAATTTCTAAGGTACAATTGCTCTATTGAGTCACCACGAAAAGGCTGGAGCTTCATGCATCCTGGGAGACTCACACATTTGCATGAAGGACTTCCTGTTAAAAATGGAACAAGATACATTGCAGTGTCATTTATAGATCCCTAAGTTATTTACTTTTCATTGAATTGAAATTTATTTTGGATGAATGACTGGCATGAACACG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feifei Xu et al.
Cancer cell international, 17, 54-54 (2017-05-17)
Intra-tumoral hypoxia and increases in extracellular level of transforming growth factor β1 (TGF-β1), which are common findings in cancer, are associated with an increased risk of metastasis and mortality. Moreover, metastasis is the leading cause of death of patients with
Wei Liu et al.
Scientific reports, 8(1), 11905-11905 (2018-08-11)
Metastasis associates with late stages of lung cancer progression and remains the main cause of patient death due to the lack of clinically effective therapeutics. Here we report that the transcription factor GATA3 and its co-factor FOG2 commonly promote the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique