Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU089751

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTACCAGATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGC

Numéro d'accès Ensembl | humain

ENSG00000124813

Numéro d'accès NCBI

NM_004348

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RUNX2(860) , RUNX2(860)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Uwe Raaz et al.
Circulation research, 117(6), 513-524 (2015-07-26)
Accelerated arterial stiffening is a major complication of diabetes mellitus with no specific therapy available to date. The present study investigates the role of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) as a potential mediator and therapeutic target
Engin Kaptan et al.
Journal of cellular biochemistry, 118(11), 3911-3919 (2017-04-09)
Runx2 promotes metastatic ability of cancer cells by directly activating some of the mediators regarding malignancy. Galectin-3 (Gal-3) extensively expressed in normal and transformed cells and it is responsible for many cellular processes. In this study, we aimed to investigate
Chen-Ling Zhang et al.
Biochemical and biophysical research communications, 482(4), 1469-1476 (2016-12-15)
Deregulation of epigenetic modification by microRNAs (miRNAs) contributes to the development of estrogen deficiency, a hallmark of the multigenic endocrine disorder polycystic ovary syndrome (PCOS), but its etiology remains unclear. Previous study has pointed to a tight association between miR-320a
Mingkun Han et al.
OncoTargets and therapy, 11, 6305-6316 (2018-10-16)
It was previously reported that downregulation of miR-218 promoted thyroid cancer cell invasion, migration, and proliferation. However, the biological functions of miR-218 and its possible regulatory mechanisms in papillary thyroid cancer (PTC) cells are still elusive. The expression levels of
Rajnee Kanwal et al.
Cancer letters, 430, 25-33 (2018-05-19)
The role of CD133 (Prominin-1) as a cancer stem cell marker may be useful for therapeutic approaches and prognostication in prostate cancer patients. We investigated the stem-cell-related function and biological features of a subpopulation of CD133+ cells isolated from established primary
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique