Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU084871

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAAATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAGGATGGACATGATATTGAGAACGAGTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAGAAGATGCAGTTGCCAGAACTGCCCAAGGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAGTCCATCAGACAGAGGAACCTTCTCACCAGGATGCGGATAAATAATGTTTTCAAGGATTTCCTAAAGGAATTTAACAACAAGACCATTTGTGACAGCAGCGTGTCCACGCATGACCTGAAGGTGAAATACTTGGCTACCTTGGAAACTTTGACAAAACATTACGGTGCTGAAATATTTGAGACTTCCATGTTACTGATTTCATCAGAAAATGAGATGAATTGGTTTCATTCGAATGACGGTGGAAACGTTCTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3695-3704 (2016-09-25)
JAK2 genetic variants are associated with inflammatory bowel disease (IBD) and JAK inhibitors are being evaluated for therapy targeting immune-mediated diseases, including IBD. As JAK pathway-mediated cytokine regulation varies across cell types and stimulation conditions, we examined how JAK signaling
Han Liu et al.
Oncotarget, 8(24), 38113-38135 (2017-05-13)
Human colon cancers express higher levels of NADPH oxidase 1 [NOX1] than adjacent normal epithelium. It has been suggested that reactive oxygen species [ROS] derived from NOX1 contribute to DNA damage and neoplastic transformation in the colon, particularly during chronic
Li-Chuan Chan et al.
The Journal of clinical investigation, 129(8), 3324-3338 (2019-07-16)
Glycosylation of immune receptors and ligands, such as T cell receptor and coinhibitory molecules, regulates immune signaling activation and immune surveillance. However, how oncogenic signaling initiates glycosylation of coinhibitory molecules to induce immunosuppression remains unclear. Here we show that IL-6-activated
Elisabeth Losdyck et al.
The Journal of biological chemistry, 290(48), 29022-29034 (2015-10-09)
JAK1 and JAK3 are recurrently mutated in acute lymphoblastic leukemia. These tyrosine kinases associate with heterodimeric cytokine receptors such as IL-7 receptor or IL-9 receptor, in which JAK1 is appended to the specific chain, and JAK3 is appended to the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique