Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU083191

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTGGGTGTGGAACTGGAATTCTCTCTATGTTTGCTGCTAAAGCTGGGGCGAAGAAGGTTCTTGGAGTTGATCAATCTGAAATACTTTACCAGGCAATGGATATTATAAGACTAAATAAACTTGAAGATACTATTACACTAATTAAAGGAAAGATTGAAGAAGTTCATCTTCCTGTAGAAAAAGTAGATGTTATCATATCTGAGTGGATGGGCTATTTTCTTCTGTTTGAGTCTATGTTAGATTCTGTCCTTTATGCAAAGAACAAATACTTGGCAAAAGGAGGCTCGGTCTACCCTGACATTTGCACTATCAGCCTTGTAGCAGTGAGTGATGTGAATAAACATGCTGATAGAATTGCTTTTTGGGATGATGTCTATGGCTTCAAGATGTCCTGCATGAAGA

Numéro d'accès Ensembl | humain

ENSG00000185238

Numéro d'accès NCBI

NM_005788

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRMT3(10196) , PRMT3(10196)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mamta Verma et al.
Communications biology, 4(1), 109-109 (2021-01-27)
Protein arginine methyltransferase 3 (PRMT3) regulates protein functions by introducing asymmetric dimethylation marks at the arginine residues in proteins. However, very little is known about the interaction partners of PRMT3 and their functional outcomes. Using yeast-two hybrid screening, we identified
Zhang Min et al.
Cell death & disease, 10(8), 581-581 (2019-08-06)
Histone arginine methylation, which is catalyzed by protein arginine methyltransferases (PRMTs), plays a key regulatory role in various biological processes. Several PRMTs are involved in skeletal development; however, their role in the osteogenic differentiation of mesenchymal stem cells (MSCs) is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique