Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU082131

Sigma-Aldrich

MISSION® esiRNA

targeting human FMR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCTCAAAGCGAGCACATATGCTGATTGACATGCACTTTCGGAGTCTGCGCACTAAGTTGTCTCTGATAATGAGAAATGAAGAAGCTAGTAAGCAGCTGGAGAGTTCAAGGCAGCTTGCCTCGAGATTTCATGAACAGTTTATCGTAAGAGAAGATCTGATGGGTCTAGCTATTGGTACTCATGGTGCTAATATTCAGCAAGCTAGAAAAGTACCTGGGGTCACTGCTATTGATCTAGATGAAGATACCTGCACATTTCATATTTATGGAGAGGATCAGGATGCAGTGAAAAAAGCTAGAAGCTTTCTCGAATTTGCTGAAGATGTAATACAAGTTCCAAGGAACTTAGTAGGCAAAGTAATAGGAAAAAATGGAAAGCTGATTCAGGAGATTGTGGACAAGTCAGGAGTTGTGAGGGTGAGGATTGAGGCTGAAA

Numéro d'accès Ensembl | humain

ENSG00000102081

Numéro d'accès NCBI

NM_002024

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FMR1(2332) , FMR1(2332)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Muzammil Ahmad et al.
Nucleic acids research, 44(13), 6335-6349 (2016-06-04)
DNA Topoisomerases are essential to resolve topological problems during DNA metabolism in all species. However, the prevalence and function of RNA topoisomerases remain uncertain. Here, we show that RNA topoisomerase activity is prevalent in Type IA topoisomerases from bacteria, archaea
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
Laurent Ferron et al.
Neurobiology of disease, 138, 104779-104779 (2020-01-29)
Fragile X syndrome (FXS), the most common form of inherited intellectual disability and autism, results from the loss of fragile X mental retardation protein (FMRP). We have recently identified a direct interaction of FMRP with voltage-gated Ca2+ channels that modulates

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique