Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU081641

Sigma-Aldrich

MISSION® esiRNA

targeting human SYK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTGCAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATGGGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTGTTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGTGCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCTCCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTGTTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Morgan Black et al.
Oral oncology, 101, 104529-104529 (2019-12-23)
Spleen tyrosine kinase (SYK) is a promoter of cell survival in a variety of cell types, including normal and cancerous epithelial cells. We hypothesized that SYK would an important therapeutic target to inhibit for the treatment of HNSCC. SYK protein
Pan Gao et al.
Oncotarget, 8(48), 83900-83912 (2017-11-16)
Spleen tyrosine kinase (SYK), a non-receptor cytoplasmic tyrosine enzyme, is well known for its ability in certain pathways through immune receptors. Recently
George E Duran et al.
PloS one, 14(1), e0210879-e0210879 (2019-01-23)
In a previously published study, higher levels of spleen tyrosine kinase (Syk) were observed in recurrent post-chemotherapy ovarian cancers compared to primary tumors. Syk inhibition was found to stabilize microtubules and potentiate paclitaxel activity in cellular models of taxane-resistant ovarian

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique