Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU078371

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP7B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAAGGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTGGAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACCTTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGTTTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCTTGCTTGGGGAATGTTGTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Navasona Krishnan et al.
Genes & development, 32(13-14), 944-952 (2018-06-28)
The levels of copper, which is an essential element in living organisms, are under tight homeostatic control. Inactivating mutations in ATP7B, a P-type Cu-ATPase that functions in copper excretion, promote aberrant accumulation of the metal, primarily the in liver and
Junko Fujiyoshi et al.
Scientific reports, 9(1), 1535-1535 (2019-02-09)
Wilson's disease (WD) is an inherited metabolic disease arising from ATPase copper transporting beta gene (ATP7B) mutation. Orthotoropic liver transplantation is the only radical treatment of fulminant WD, although appropriate donors are lacking at the onset of emergency. Given the
Xue Fu et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 432-451 (2014-03-13)
Regulation of cellular copper (Cu) homeostasis involves Cu-transporting ATPases (Cu-ATPases), i.e., ATP7A and ATP7B. The question as to how these Cu-ATPases in brain barrier systems transport Cu, i.e., toward brain parenchyma, cerebrospinal fluid (CSF), or blood, remained unanswered. This study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique