Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU073601

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGATTGACGACAAGTGCTGAACAGTGGAGGAAGAGGGACAGATGAATGCCGTGGATTGCACGTGGCCTCTTGAGCAGTGGCTGGTCCAGGGCTAGTGACTTGTGTCCCATGATCCCTGTGTTGTCTCTAGAGCAGGGATTAACCTCTGCACTACTGACATGTGGGGCCAGGTCACCCTTTGCTGTGAGGCTGTCCTGTACATTGTGGGATGTTCAGCACTGTCCCTTGCCTCAATGCCAGTAACGCGTCTTCCTGAGTGGTGCCAAACAAAAAGGTTCTCAGGTGTTGCCAAATATGTCCTGGGGTATAAAACTTTCCTCGCCTGACAACCACTGGTCTGTAGGGATTTTTGGCTACACACAAACCAGTATCGCTCATAGATCAGCAAACCGGGGCCTACTAGAGT

Numéro d'accès Ensembl | humain

ENSG00000132906

Numéro d'accès NCBI

NM_032996

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CASP9(842) , CASP9(842)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Meng Yu et al.
Molecular carcinogenesis, 53(7), 505-513 (2013-01-30)
Activation of telomerase is a key element in oncogenesis and resistance to apoptosis for many cancers. Some histone deacetylase inhibitors (HDACi) or chemotheraputic agents have been reported to downregulate the expression of human telomerase reverse transcriptase (hTERT). However, whether hTERT
Joungjwa Ahn et al.
Archives of pharmacal research, 37(6), 783-792 (2014-01-08)
Small-sized particles are more suitable for targeted delivery and are therapeutically more effective than large-sized particles. In this study, we investigated the anticancer effects of ultrafine particles of Ulmus davidiana var. japonica (ufUJ) on human gastric cancer cell lines SNU-1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique