Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU069741

Sigma-Aldrich

MISSION® esiRNA

targeting human POSTN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATCATCCATGGGAACCAGATTGCAACAAATGGTGTTGTCCATGTCATTGACCGTGTGCTTACACAAATTGGTACCTCAATTCAAGACTTCATTGAAGCAGAAGATGACCTTTCATCTTTTAGAGCAGCTGCCATCACATCGGACATATTGGAGGCCCTTGGAAGAGACGGTCACTTCACACTCTTTGCTCCCACCAATGAGGCTTTTGAGAAACTTCCACGAGGTGTCCTAGAAAGGATCATGGGAGACAAAGTGGCTTCCGAAGCTCTTATGAAGTACCACATCTTAAATACTCTCCAGTGTTCTGAGTCTATTATGGGAGGAGCAGTCTTTGAGACGCTGGAAGGAAATACAATTGAGATAGGATGTGACGGTGACAGTATAACAGTAAATGGAATCAAAATGGTGAACAAAAAGGATATTGTGACAAATAATGGTGTGATCCATTTGATTGA

Numéro d'accès Ensembl | humain

ENSG00000133110

Numéro d'accès NCBI

NM_006475

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... POSTN(10631) , POSTN(10631)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

A Tomaru et al.
Gene therapy, 24(11), 706-716 (2017-08-19)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease with a median survival of 3-4 years after diagnosis. It is the most frequent form of a group of interstitial pneumonias of unknown etiology. Current available therapies prevent deterioration of lung function
Yujin Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 88, 342-348 (2017-01-26)
Hypoxia has been suggested to induce chemoresistance in tumor cells. In this study, we aimed to test the hypothesis that hypoxia-inducible factor-1alpha (HIF-1α)/periostin axis might promote arsenic trioxide resistance in hepatocellular carcinoma (HCC) cells under hypoxia. HCC cells were exposed
Jae Eun Um et al.
Scientific reports, 7(1), 8490-8490 (2017-08-19)
Diabetic nephropathy, the major cause of chronic kidney disease, is associated with progressive renal fibrosis. Recently, accumulation of periostin, an extracellular matrix protein, was shown to augment renal fibrosis. Aptamers have higher binding affinities without developing the common side effects
Xiting Han et al.
Journal of cellular physiology, 234(8), 14170-14180 (2019-01-12)
The human cervical cancer (CC) has been identified as one of the most common tumors in women, and the molecular regulation in CC still remains unclear. The dysregulation of periostin has been found in a variety of cancers, but whether
Xiaofan Guo et al.
Oncotarget, 7(49), 80521-80542 (2016-09-08)
Tumor-associated macrophages (TAMs) are enriched in gliomas and help create a tumor-immunosuppressive microenvironment. A distinct M2-skewed type of macrophages makes up the majority of glioma TAMs, and these cells exhibit pro-tumor functions. Gliomas contain large hypoxic areas, and the presence
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique