Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU068001

Sigma-Aldrich

MISSION® esiRNA

targeting human NR3C1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAAGTGTTATATGCAGGATATGATAGCTCTGTTCCAGACTCAACTTGGAGGATCATGACTACGCTCAACATGTTAGGAGGGCGGCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAGTTCCTAAGGACGGTCTGAAGAGCC

Numéro d'accès Ensembl | humain

ENSG00000113580

Numéro d'accès NCBI

NM_000176

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NR3C1(2908) , NR3C1(2908)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Samaresh Sau et al.
Molecular and cellular biochemistry, 436(1-2), 119-136 (2017-06-07)
Glucocorticoid, such as dexamethasone (Dex) is often used along with chemotherapy to antagonize side effects of chemotherapy. However, sustained use of Dex frequently develops drug resistance in patients. As a strategy to re-induce drug sensitivity, we planned to modify Dex
Benjamin Small et al.
The Journal of clinical endocrinology and metabolism, 105(3) (2019-10-31)
The selective progesterone modulator ulipristal acetate (ulipristal) offers a much-needed therapeutic option for the clinical management of uterine fibroids. Although ulipristal initially passed safety evaluations in Europe, postmarketing analysis identified cases of hepatic injury and failure, leading to restrictions on
Weiping Qin et al.
Biochemical and biophysical research communications, 450(2), 979-983 (2014-06-28)
Glucocorticoids stimulate muscle atrophy through a cascade of signals that includes activation of FoxO transcription factors which then upregulate multiple genes to promote degradation of myofibrillar and other muscle proteins and inhibit protein synthesis. Our previous finding that glucocorticoids upregulate

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique