Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU065921

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGTGGCTCTTGAAATTGGGGCTGACCTCCCATCTAATCATGTCATTGATCGCTGGCTTGGGGAGCCCATCAAAGCAGCCATTCTCCCCACTAGCATTTTCCTGACCAATAAGAAGGGATTTCCTGTTCTTTCTAAGATGCACCAGAGGCTCATCTTCCGGCTCCTCAAGTTGGAGGTGCAGTTCATCATCACAGGCACCAACCACCACTCAGAGAAGGAGTTCTGCTCCTACCTCCAATACCTGGAATACTTAAGCCAGAACCGTCCTCCACCTAATGCCTATGAACTCTTTGCCAAGGGCTATGAAGACTATCTGCAGTCCCCGCTTCAGCCACTGATGGACAATCTGGAATCTCAGACATATGAAGTGTTTGAAAAGGACCCCATCAAATACTCTCAGTACCAGCAGGCC

Numéro d'accès Ensembl | humain

ENSG00000100462

Numéro d'accès NCBI

NM_006109

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRMT5(10419) , PRMT5(10419)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

PRMTs (protein arginine N-methyltransferases) are responsible for the methylation of arginine residues in histones. PRMT5 causes monomethylation and symmetric dimethylation reactions. It works as an oncogene is some neoplasms and is associated with cell proliferation, inhibition of cell death and regulation of tumor suppressor genes. PRMT5 is also involved in stem cell maintenance by controlling differentiation-associated genes. It is involved in cellular responses, including neurogenesis and myogenesis metabolic events, somatic cell reprogramming, regulation of Golgi apparatus, ribosome biogenesis and neuronal spreading and movements.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dongying Chen et al.
Journal of cellular and molecular medicine, 21(4), 781-790 (2016-11-20)
To probe the role of protein arginine methyltransferase 5 (PRMT5) in regulating inflammation, cell proliferation, migration and invasion of fibroblast-like synoviocytes (FLSs) from patients with rheumatoid arthritis (RA). FLSs were separated from synovial tissues (STs) from patients with RA and
Myc and Omomyc functionally associate with the Protein Arginine Methyltransferase 5 (PRMT5) in glioblastoma cells.
Mongiardi MP
Scientific Reports, 5, 15494-15494 (2015)
Nan Wang et al.
Cell death & disease, 11(10), 864-864 (2020-10-17)
Metastasis is the main cause of laryngeal cancer-related death; its molecular mechanism remains unknown. Here we identify protein arginine methyltransferase 5 (PRMT5) as a new metastasis-promoting factor in laryngeal carcinoma, and explore its underlying mechanism of action in regulating laryngeal
Ju-Yeon Jeon et al.
Oncology reports, 40(1), 536-544 (2018-05-12)
Protein arginine methyltransferase 5 (PRMT5) is a protein that catalyzes transfer of methyl groups to the arginine residues of proteins and is involved in diverse cellular and biological responses. While the participation of PRMT5 in cancer progression has been increasingly documented
X Deng et al.
Oncogene, 36(9), 1223-1231 (2016-08-23)
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique