Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU065671

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACCCAGAACGCTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTGCCCGTTTAATAAAAGAATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Taiyo Otoshi et al.
PloS one, 10(12), e0145769-e0145769 (2015-12-30)
Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a part of the ribonucleoprotein complex which regulates diverse biological events. While overexpression of hnRNP K has been shown to be related to tumorigenesis in several cancers, both the expression patterns and biological mechanisms
Agata Swiatkowska et al.
RNA biology, 17(10), 1402-1415 (2020-05-26)
The p53 protein is one of the transcription factors responsible for cell cycle regulation and prevention of cancer development. Its expression is regulated at the transcriptional, translational and post-translational levels. Recent years of research have shown that the 5' terminus
Xue Gong et al.
Oncotarget, 8(12), 18657-18669 (2017-04-21)
Clear cell renal cell carcinomas (ccRCC) show a broad range of clinical behavior, and prognostic biomarkers are needed to stratify patients for appropriate management. We sought to determine whether long intergenic non-coding RNAs (lincRNAs) might predict patient survival. Candidate prognostic
Diane Moujalled et al.
Human molecular genetics, 26(9), 1732-1746 (2017-03-24)
TAR DNA binding protein 43 (TDP-43) is a major disease-associated protein involved in the pathogenesis of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U). Our previous studies found a direct association between TDP-43 and heterogeneous nuclear
David Colognori et al.
Molecular cell, 74(1), 101-117 (2019-03-05)
During X-inactivation, Xist RNA spreads along an entire chromosome to establish silencing. However, the mechanism and functional RNA elements involved in spreading remain undefined. By performing a comprehensive endogenous Xist deletion screen, we identify Repeat B as crucial for spreading Xist

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique