Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU065141

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATGGACACAGCCATTATGCCTCTGAGTCGCTTCCCTCCAAGAAGGACCAGGAGGAGGGGGTGATGGAGAAGCTGCAGAACGGGGACCTGGACCACATGATTCCTCAGCACTGCAGCAGTGAGCTGGACGGCAAGGCGCCCATGGTGGACGAGAAGGTCATTGTGGGCTCGCTCTCTGTGCAGGACCTGCAGGCTTCCCAGAGTGCTTGCTACTGGCTGAAAGGTGTCCGCTACTCTGATATCGGCACTCTGGCCTGGATGATCACTCTGAGCGACGGCCTCCATAATTTCATCGATGGCCTGGCCATCGGTGCTTCCTTCACTGTGTCAGTTTTCCAAGGCATCAGCACCTCGGTGGCCATCCTCTGTGAGGAGTTCCCACATGAGCTAGGAGACTTTGTCATCCTGCTCAACG

Numéro d'accès Ensembl | humain

ENSG00000104635

Numéro d'accès NCBI

NM_015359

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC39A14(23516) , SLC39A14(23516)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tolunay Beker Aydemir et al.
The Journal of biological chemistry, 291(46), 23939-23951 (2016-10-21)
Zinc influences signaling pathways through controlled targeted zinc transport. Zinc transporter Zip14 KO mice display a phenotype that includes impaired intestinal barrier function with low grade chronic inflammation, hyperinsulinemia, and increased body fat, which are signatures of diet-induced diabetes (type
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular
Yu Han et al.
Metallomics : integrated biometal science, 12(3), 346-362 (2020-01-18)
Zinc is the second most abundant transition metal in humans and an essential nutrient required for growth and development of newborns. During lactation, mammary epithelial cells differentiate into a secretory phenotype, uptake zinc from blood circulation, and export it into

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique