Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU064181

Sigma-Aldrich

MISSION® esiRNA

targeting human PKLR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGAACCTCCAGAAGCCATCTGGGCAGATGATGTAGATCGCCGGGTGCAATTTGGCATTGAAAGTGGAAAGCTCCGTGGCTTCCTCCGTGTTGGAGACCTGGTGATTGTGGTGACAGGCTGGCGACCTGGCTCCGGCTACACCAACATCATGCGGGTGCTAAGCATATCCTGAGACGCCCCTCCCTCCTCTGGCCCAGCCTACCCTTGTACCCCATCCCTTCCTCCCCAGTCTACGTTCTCCAGCCCACACCCCTCCAAAGCCCCACCTTTAAGTCCTCTCTTCTCTATTCCTGACCCTCCCTACCTGAGGCCTATCTGAGACTATAACTGTCATCTAGCCCCTTCGAGGTTGCCCCTTCCCCATCTCCATTTCACACAGGTCCTGAAAGTCTGTGTCCAATTATGCACTGGCCAC

Numéro d'accès Ensembl | humain

ENSG00000143627

Numéro d'accès NCBI

NM_000298

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PKLR(5313) , PKLR(5313)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoqiong Duan et al.
Journal of virology, 92(7) (2018-01-13)
Hepatitis C virus (HCV) infection has been shown to regulate microRNA 130a (miR-130a) in patient biopsy specimens and in cultured cells. We sought to identify miR-130a target genes and to explore the mechanisms by which miR-130a regulates HCV and hepatitis
Stephanie Dabo et al.
Scientific reports, 7(1), 16129-16129 (2017-11-25)
PKR is a cellular kinase involved in the regulation of the integrative stress response (ISR) and pro-inflammatory pathways. Two N-terminal dsRNA Binding Domains (DRBD) are required for activation of PKR, by interaction with either dsRNA or PACT, another cellular DRBD-containing
D C Tanner et al.
Cell death and differentiation, 22(9), 1489-1501 (2015-01-31)
Neuroinflammation associated with degenerative central nervous system disease and injury frequently results in oligodendrocyte death. While promoting oligodendrocyte viability is a major therapeutic goal, little is known about protective signaling strategies. We report that in highly purified rat oligodendrocytes, interferon

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique