Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU063661

Sigma-Aldrich

MISSION® esiRNA

targeting human METTL3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCCAGCCAAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCACTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGAACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACCAAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAAGTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGT

Numéro d'accès Ensembl | humain

ENSG00000165819

Numéro d'accès NCBI

NM_019852

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... METTL3(56339) , METTL3(56339)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tianfang Xia et al.
Pathology, research and practice, 215(11), 152666-152666 (2019-10-14)
Epigenetic modifications are involved in carcinogenesis and METTL3 is involved in RNA methylation. This study aimed to explore the role of the RNA m6A methyltransferase METTL3 in pancreatic cancer cells. The m6A modification was analyzed in human pancreatic cancer and
Jiarong Cai et al.
OncoTargets and therapy, 12, 9143-9152 (2019-12-07)
N6-methyladenosine (m6A) is the most abundant internal modification on eukaryotic mRNA and gained increasing attention recently. More and more evidence suggest that m6A methylation plays crucial role in tumor genesis and development. However, its role in prostate cancer remains largely
Shiyan Gu et al.
Toxicology letters, 292, 1-11 (2018-04-24)
N6-methyladenosine (m6A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO2) for about
Daniel A Lorenz et al.
RNA (New York, N.Y.), 26(1), 19-28 (2019-10-19)
Direct RNA sequencing holds great promise for the de novo identification of RNA modifications at single-coordinate resolution; however, interpretation of raw sequencing output to discover modified bases remains a challenge. Using Oxford Nanopore's direct RNA sequencing technology, we developed a
Ly P Vu et al.
Nature medicine, 23(11), 1369-1376 (2017-09-19)
N6-methyladenosine (m6A) is an abundant nucleotide modification in mRNA that is required for the differentiation of mouse embryonic stem cells. However, it remains unknown whether the m6A modification controls the differentiation of normal and/or malignant myeloid hematopoietic cells. Here we
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique