Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU063491

Sigma-Aldrich

MISSION® esiRNA

targeting human ELAVL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCT

Numéro d'accès Ensembl | humain

ENSG00000066044

Numéro d'accès NCBI

NM_001419

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ELAVL1(1994) , ELAVL1(1994)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guillaume Gauchotte et al.
The Journal of pathology, 242(4), 421-434 (2017-05-12)
HuR regulates cytoplasmic mRNA stability and translatability, and the HuR expression level has been shown to correlate with poor disease outcome in several cancer types; however, the prognostic value and potential pro-oncogenic properties of HuR in meningioma remain unclear. Thus
Kotb Abdelmohsen et al.
RNA biology, 14(3), 361-369 (2017-01-13)
HuR influences gene expression programs and hence cellular phenotypes by binding to hundreds of coding and noncoding linear RNAs. However, whether HuR binds to circular RNAs (circRNAs) and impacts on their function is unknown. Here, we have identified en masse
Shuran Li et al.
Science China. Life sciences, 60(6), 617-626 (2017-06-25)
APOBEC3 protein families, a DNA cytidine deaminase, were up-regulated in multiple tumors. However, the relationship between Hepatocellular carcinoma (HCC) and APOBEC3B (A3B) remains unknown. It has been confirmed that interleukin-6 (IL-6) has significant impacts on oncogenesis of HCC. Here, we
Sun Kyoung Lee et al.
Scientific reports, 7(1), 9610-9610 (2017-08-31)
Breast cancer mainly spreads to bone, causing decreased survival of patient. Human antigen R (HuR) and chemokines are important molecules associated with mRNA stability and cell-cell interaction in cancer biology. Here, HuR knockdown inhibited bone metastasis and osteolysis of metastatic
Aya Yanagawa-Matsuda et al.
Oncology reports, 41(2), 954-960 (2018-11-16)
AU-rich elements (AREs) are RNA elements that enhance the rapid decay of mRNA. The fate of ARE-mRNA is controlled by ARE-binding proteins. HuR, a member of the embryonic lethal abnormal vision (ELAV) family of RNA-binding proteins, is involved in the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique