Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU060941

Sigma-Aldrich

MISSION® esiRNA

targeting human MXI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGTGCAGTTGAGTTGTGTGTTAATGTTAGACTATCCCTTTGTGAGTGACACTTTAACAGCATTCACTGCTTCTATATATAGTGTACCATCTTGGTCATACATTACGCCTCAACATATACTTGTGCTCTTCCTTTGCCTCCAGAAGAAGTTTTTCCTTGATTGTGCTATGTTTCAGTGGAAGAAATTCTTTGAAGTAGATGTGAGTGAAAAACTGCATGCCTTTAGAAGCCCAGTATCAGAACTTGCTACGTTTCAGGTGCTAGGGACTTAATGAAAAACAGGACAAAACAATTCCTTTTTGTGGCCCAGGTAAATTATTTCTGGTTTCACTTATAATTACTAATGGCTGAGTCAAGATGTTGTCTCTGTGTTTGCTTACTCTTGATCAAGTGTGAGACAGTTTGAAGACTGTGCTACCATACAAAGTGAATGAAGCCAGTGACTAAGCTTCTGTTTGTTTTGTTATTCTCATGGCCTTCGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jianwen Zhou et al.
PloS one, 8(12), e83055-e83055 (2014-01-01)
Gliomas are the most common and aggressive primary tumors in the central nervous system. Recently, Max interactor-1 (MXI1), an antagonist of c-Myc that is involved in brain tumor progression, has been reported to be deregulated in a variety of tumors
Stacie E Dodgson et al.
Genes & development, 30(20), 2259-2271 (2016-11-04)
Aneuploidy-or an unbalanced karyotype in which whole chromosomes are gained or lost-causes reduced fitness at both the cellular and organismal levels but is also a hallmark of human cancers. Aneuploidy causes a variety of cellular stresses, including genomic instability, proteotoxic
Xingkang Wu et al.
Biochemical and biophysical research communications, 499(4), 927-933 (2018-04-08)
Colorectal cancer (CRC) is the third most prevalent malignancy worldwide. New understandings about this disease are urgently required to guide clinical therapies. In this study, we focused on the effects of the small molecule PMN on CRC cells. PMN dose-dependently
Ana Vanessa Nascimento et al.
Acta biomaterialia, 47, 71-80 (2016-10-19)
Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique