Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU060321

Sigma-Aldrich

MISSION® esiRNA

targeting human ALDH1A3, RP11-66B24.4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGGTCTTTGTGGATTGCATGTTGACATTGACCGTGAGATTCGGCTTCAAACCAATACTGCCTTTGGAATATGACAGAATCAATAGCCCAGAGAGCTTAGTCAAAGACGATATCACGGTCTACCTTAACCAAGGCACTTTCTTAAGCAGAAAATATTGTTGAGGTTACCTTTGCTGCTAAAGATCCAATCTTCTAACGCCACAACAGCATAGCAAATCCTAGGATAATTCACCTCCTCATTTGACAAATCAGAGCTGTAATTCGCTTTAACAAATTACGCATTTCTATCACGTTCACTAACAGCTTATGATAAGTCTGTGTAGTCTTCCTTTTCTCCAGTTCTGTTACCCAATTTAGATTAGTAAAGCGTACACAACTGGAAAGACTGCTGTAATAACACAGCCTTGTTATTTTTAAGTCCTATTTTGATATTAATTTCTGATTAGTTAGTAAATAACACCTGGATTCTATGGAGGACCTCGGTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Daisuke Yamashita et al.
Molecular cancer therapeutics, 19(5), 1134-1147 (2020-03-05)
The development of efficacious therapies targeting metastatic spread of breast cancer to the brain represents an unmet clinical need. Accordingly, an improved understanding of the molecular underpinnings of central nervous system spread and progression of breast cancer brain metastases (BCBM)
Vita Golubovskaya et al.
Journal of cancer research and clinical oncology, 141(9), 1613-1631 (2015-02-07)
Focal adhesion kinase is an important survival signal in cancer. Recently, we demonstrated that the autophosphorylation inhibitor of FAK, Y15, effectively inhibited cancer cell growth. We detected many cancer cell lines sensitive to Y15 and also detected several cell lines

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique