Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU056141

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGAAACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGACTTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGGAAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGGTGAATATAGTGCTGCTATGTTGACATTATTCTTCCTAGAGAAGATTATCCTGTCCTGCAAACTGCAAATAGTAGTTCCTGAAGTGTTCACTTCCCTGTTTATCCAAACATCTTCCAATTTATTTTGTTTGTTCGGCATACAAATAATACCTATATCTTAATTGTAAGCAAAACTTTGGGGAAAGG

Numéro d'accès Ensembl | humain

ENSG00000149554

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CHEK1(1111) , CHEK1(1111)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yan Liu et al.
Cancer research, 77(18), 5068-5076 (2017-07-30)
Cells lacking the tumor suppressor gene
Ming Bai et al.
Cell biology international, 42(7), 781-793 (2017-12-23)
The ATM and Rad3-related (ATR)/checkpoint kinase 1 (Chk1) pathway plays a pivotal role in DNA damage sensor and modulating homologous recombination. Recently, emerging evidence demonstrated that Chk1 phosphorylation was associated with chemotherapy and radiotherapy resistance. In this study, we explored
L M Sarmento et al.
Oncogene, 34(23), 2978-2990 (2014-08-19)
Checkpoint kinase 1 (CHK1) is a key component of the ATR (ataxia telangiectasia-mutated and Rad3-related)-dependent DNA damage response pathway that protect cells from replication stress, a cell intrinsic phenomenon enhanced by oncogenic transformation. Here, we show that CHK1 is overexpressed
Wei-Hsun Hsu et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 14(6), 1032-1045 (2019-02-17)
Platinum-based chemotherapy remains the standard treatment for patients with SCLC, but the benefit of the treatment is often hampered by rapid development of drug resistance. Thus far, there is no targeted therapy available for SCLC. More than 90% of SCLC
Lei Duan et al.
Oncogene, 38(28), 5643-5657 (2019-04-11)
Platinum-based drugs such as cisplatin (CP) are the first-line chemotherapy for non-small-cell lung carcinoma (NSCLC). Unfortunately, NSCLC has a low response rate to CP and acquired resistance always occurs. Histone methylation regulates chromatin structure and is implicated in DNA repair.
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique