Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU055911

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC5A8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAGAAAGTGTCTGCACCAGACCAGCTCATGCCTTATTTGGTACTGGACATTCTGCAAGATTATCCAGGACTTCCTGGACTTTTTGTGGCCTGTGCTTACAGTGGGACATTAAGCACAGTGTCCTCCAGTATTAATGCCTTAGCAGCAGTAACTGTGGAAGATCTAATCAAACCTTACTTCAGATCGCTCTCAGAAAGGTCTCTGTCTTGGATTTCCCAAGGAATGAGTGTGGTGTATGGAGCCCTGTGTATTGGAATGGCTGCGCTGGCGTCACTTATGGGAGCTTTGTTGCAGGCAGCACTCAGCGTATTTGGTATGGTTGGTGGACCACTTATGGGCCTGTTCGCTTTGGGCATTTTGGTTCCCTTTGCCAACTCAATTGGAGCACTTGTTGGTCTGATGGCTGGATTTGCCATTTCTCTATGGGTTGGAATTGGAGCTCAAA

Numéro d'accès Ensembl | humain

ENSG00000139357

Numéro d'accès NCBI

NM_145913

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SLC5A8(160728) , SLC5A8(160728)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Adriana López-Barradas et al.
American journal of physiology. Cell physiology, 311(5), C720-C734 (2016-11-03)
SMCTs move several important fuel molecules that are involved in lipid, carbohydrate, and amino acid metabolism, but their regulation has been poorly studied. Insulin controls the translocation of several solutes that are involved in energetic cellular metabolism, including glucose. We
Taoufik Nedjadi et al.
Experimental physiology, 99(10), 1335-1347 (2014-08-31)
The diet of the horse, pasture forage (grass), is fermented by the equine colonic microbiota to short-chain fatty acids, notably acetate, propionate and butyrate. Short-chain fatty acids provide a major source of energy for the horse and contribute to many

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique