Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU054411

Sigma-Aldrich

MISSION® esiRNA

targeting human USF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGCACTGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTACTGCAGGGAGGAAGCCAGCGCTCAATTGCCCCTAGGACTCACCCTTATTCCCCGAAGTCAGAAGCTCCCCGGACGACTCGGGATGAGAAACGCAGGGCTCAGCATAATGAAGTGGAGCGTCGCCGCCGAGACAAGATCAACAACTGGATCGTGCAGCTCTCCAAGATAATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGGATTCTATCCAAAGCTTGTGATTATATCCAGGAGCTTCGGCAGAGTAACCACCGCTTGTCTGAAGAACTGCAGGGACTTGACCAACTGCAGCTGGACAATGACGTGCTTCGACAACAGGTGGAAGATCTTAAAAACAAGAATCTGCTGCTTCGAGCTCAGTTGCGGCACCACGGATTAGAGGTCGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiangxiang Liu et al.
Molecular therapy. Nucleic acids, 22, 750-765 (2020-11-25)
Hepatocellular carcinoma (HCC), one of the most aggressive malignancies, ranks as the fourth leading cause of cancer-related deaths worldwide. Emerging evidence indicates that RNA N6-methyladenosine (m6A) plays a critical role in tumor progression. However, the biological function of YTHDF1 in
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Jun Guo et al.
FEBS letters, 592(16), 2725-2738 (2018-07-29)
Previous studies indicate that the transcription factor upstream stimulating factor 1 (USF1) is involved in the regulation of lipid and glucose metabolism. However, the role of USF1 in lipid-induced autophagy remains unknown. Interestingly, we found that USF1 overexpression suppresses autophagy-related
Chunyu Cao et al.
International journal of cancer, 143(6), 1388-1401 (2018-04-11)
Our recent studies have shown that cross-talk between histone deacetylase 5 (HDAC5) and lysine-specific demethylase 1 (LSD1) facilitates breast cancer progression. In this work, we demonstrated that regulatory activity at -356 to -100 bp promoter element plays a critical role
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique