Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU053371

Sigma-Aldrich

MISSION® esiRNA

targeting human SYP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCGAGAGTGACCTCAGCATCGAGGTCGAGTTCGAGTACCCCTTCAGGCTGCACCAAGTGTACTTTGATGCACCCACCTGCCGAGGGGGCACCACCAAGGTCTTCTTAGTTGGGGACTACTCCTCGTCAGCCGAATTCTTTGTCACCGTGGCCGTGTTTGCCTTCCTCTACTCCATGGGGGCTCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAATAACAAAGGGCCCATGCTGGACTTTCTGGCCACGGCTGTGTTCGCCTTCATGTGGCTAGTTAGCTCATCGGCATGGGCCAAGGGGCTGTCAGATGTGAAGATGGCCACAGACCCAGAGAACATTATCAAGGAGATGCCTGTCTGCCGCCAGACAGGGAACACATGCAAGGAGCTGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Teng-Fei Li et al.
Scientific reports, 7, 45056-45056 (2017-03-23)
Bulleyaconitine (BAA) has been shown to possess antinociceptive activities by stimulation of dynorphin A release from spinal microglia. This study investigated its underlying signal transduction mechanisms. The data showed that (1) BAA treatment induced phosphorylation of CREB (rather than NF-κB)
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke
Xiaochun Yang et al.
Oncotarget, 6(8), 6203-6217 (2015-03-10)
Liver dysfunction is a common side effect associated with the treatment of dasatinib and its mechanism is poorly understood. Autophagy has been thought to be a potent survival or death factor for liver dysfunction, which may shed the light on
Bruce C McGorum et al.
Molecular & cellular proteomics : MCP, 14(11), 3072-3086 (2015-09-15)
Equine grass sickness (EGS) is an acute, predominantly fatal, multiple system neuropathy of grazing horses with reported incidence rates of ∼2%. An apparently identical disease occurs in multiple species, including but not limited to cats, dogs, and rabbits. Although the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique