Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU052581

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM1B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGATGGAACTGGATGAGCTCTATGAGTTTCCAGAGTATTCCCGAGACCCCACCATGTACCTGGCTTTGAGAAACCTCATCCTCGCACTGTGGTATACTAACTGCAAAGAAGCTCTTACTCCTCAGAAATGTATTCCTCACATCATCGTCCGGGGTCTCGTGCGTATTCGATGCGTTCAGGAAGTGGAGAGAATACTGTATTTTATGACCAGAAAAGGTCTCATCAACACTGGAGTTCTCAGCGTGGGAGCCGACCAGTATCTTCTCCCTAAGGACTACCACAATAAATCAGTCATCATTATCGGGGCTGGTCCAGCAGGATTAGCAGCTGCTAGGCAACTGCATAACTTTGGAATTAAGGTGACTGTCCTGGAAGCCAAAGACAGAATTGGAGGCCGAGTCTGGGATGATAAATCTTTTAAAGGCGTCACAGTGGGAAGAGGAGCTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Aman Kumar et al.
Molecular biology reports, 47(9), 7273-7276 (2020-08-06)
NLRP3 pathway plays a vital role in the pathogenesis of different human cancers but still the regulation of NLRP3 pathway largely unknown. Therefore, we examined the levels of NLRP3 and its downstream components (caspase-1 and IL-1β) and its relationship with
Aman Kumar et al.
Scientific reports, 9(1), 8189-8189 (2019-06-05)
Renal cell carcinoma (RCC) is the leading cause among cancer-related deaths due to urological cancers, which results in response to combination of genetic and epigenetic factors. Histone methylations have been implicated in renal tumorigenesis but their clinical significance and underlying

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique