Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU043331

Sigma-Aldrich

MISSION® esiRNA

targeting human SUZ12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAAGGCAACAAACTGAAGCAAGAGATGACCTGCATTGCCCTTGGTGTACTCTGAACTGCCGCAAACTTTATAGTTTACTCAAGCATCTTAAACTCTGCCATAGCAGATTTATCTTCAACTATGTTTATCATCCAAAAGGTGCTAGGATAGATGTTTCTATCAATGAGTGTTATGATGGCTCCTATGCAGGAAATCCTCAGGATATTCATCGCCAACCTGGATTTGCTTTTAGTCGCAACGGACCAGTTAAGAGAACACCTATCACACATATTCTTGTGTGCAGGCCAAAACGAACAAAAGCAAGCATGTCTGAATTTCTTGAATCTGAAGATGGGGAAGTAGAACAGCAAAGAACATATAGTAGTGGCCACAATCGTCTGTATTTCCATAGTGATACCTGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGATGAAAAGGATCCTGAATGGC

Numéro d'accès Ensembl | humain

ENSG00000178691

Numéro d'accès NCBI

NM_015355

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SUZ12(23512) , SUZ12(23512)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoli Wei et al.
Oncology letters, 18(2), 1607-1616 (2019-08-20)
Chemotherapy resistance is a major obstacle to the effective treatment of patients with gastric cancer (GC). Mounting evidence has indicated that the dysregulation of microRNAs (miRNAs) is associated with the sensitivity of cancer cells to chemotherapy. However, the mechanisms underlying
Young Hwa Soung et al.
Cancers, 12(8) (2020-08-14)
Triple-negative breast cancers (TNBCs) lack ER, PR and her2 receptors that are targets of common breast cancer therapies with poor prognosis due to their high rates of metastasis and chemoresistance. Based on our previous studies that epigenetic silencing of a
Lin Jin et al.
Cancer research, 77(20), 5464-5478 (2017-08-23)
NOTCH signaling exerts essential roles in normal and malignant intestinal physiology and the homeostasis of cancer stem-like cells (CSC), but the basis for this latter role remains obscure. The signaling scaffold protein STRAP is upregulated in several cancers, where it
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique