Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU042681

Sigma-Aldrich

MISSION® esiRNA

targeting human IREB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCTTGCTGCAGGTCTTTTGGCTAAAAAGGCTGTTGAAGCTGGTCTGCGTGTTAAACCTTATATAAGAACAAGTTTATCTCCAGGCAGTGGGATGGTTACACATTACCTCAGTTCAAGTGGAGTATTACCATATCTAAGTAAGCTTGGATTTGAAATCGTTGGCTATGGATGTTCAATTTGTGTGGGAAATACAGCACCCTTATCAGACGCAGTTTTAAATGCAGTAAAACAGGGTGATTTGGTTACCTGTGGAATTTTATCTGGAAACAAAAATTTTGAAGGTCGTCTTTGTGATTGTGTTCGTGCCAATTATCTTGCCTCTCCACCCTTAGTGGTAGCTTATGCCATAGCAGGCACAGTGAATATAGATTTCCAGACAGAACCTTTAGGTACTGACCCCACCG

Numéro d'accès Ensembl | humain

ENSG00000136381

Numéro d'accès NCBI

NM_004136

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IREB2(3658) , IREB2(3658)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fei Liu et al.
Cancer management and research, 11, 10891-10900 (2020-01-11)
Clear cell renal cell carcinoma (ccRCC) has the highest rate of metastasis and invasion in RCC and is the third most common adult urinary malignancy. miRNA may serve a critical role in human cancer development and progression, has been confirmed
Jin Zhang et al.
The Journal of pathology, 251(3), 284-296 (2020-04-19)
Ferredoxin reductase (FDXR) is a mitochondrial flavoprotein that initiates electron transport from NADPH to several cytochromes P450 via two electron carriers, ferredoxin 1 (FDX1) and FDX2. FDXR is the sole ferredoxin reductase in humans and plays a critical role in
Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Toshifumi Hoki et al.
Hepatology (Baltimore, Md.), 62(3), 751-761 (2015-03-11)
Increased hepatic iron accumulation is thought to be involved in the pathogenesis of nonalcoholic steatohepatitis (NASH). Hepatic iron accumulation, as well as oxidative DNA damage, is significantly increased in NASH livers. However, the precise mechanism of iron accumulation in the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique