Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU042081

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lin Lin et al.
Frontiers in pharmacology, 10, 1617-1617 (2020-02-13)
The increase of blood pressure accelerates endothelial progenitor cells (EPCs) senescence, hence a significant reduction in the number of EPCs is common in patients with hypertension. Autophagy is a defense and stress regulation mechanism to assist cell homeostasis and organelle
Meera Saxena et al.
Journal of cell science, 131(14) (2018-06-29)
The developmental programme of epithelial-mesenchymal transition (EMT), involving loss of epithelial and acquisition of mesenchymal properties, plays an important role in the invasion-metastasis cascade of cancer cells. In the present study, we show that activation of AMP-activated protein kinase (AMPK)
Manipa Saha et al.
Cancer research, 78(6), 1497-1510 (2018-01-18)
Cell detachment from the extracellular matrix triggers anoikis. Disseminated tumor cells must adapt to survive matrix deprivation, while still retaining the ability to attach at secondary sites and reinitiate cell division. In this study, we elucidate mechanisms that enable reversible
Yingshuai Zhao et al.
Cardiology, 143(1), 1-10 (2019-07-16)
The aberrant proliferation and migration of vascular smooth muscle cells (VSMCs) in the vascular wall are crucial pathological events involved in cardiovascular impairments including hypertension, heart failure, and atherosclerosis. At the molecular level, the mammalian target of rapamycin (mTOR)-ribosomal protein
Hua Yu et al.
International journal of oncology, 50(1), 161-172 (2016-12-07)
Caulerpin, a secondary metabolite from the marine invasive green algae Caulerpa cylindracea is known to induce mitochondrial dysfunctions. In this study, the anticancer property of caulerpin was assessed in a panel of colorectal cancer cell lines. We demonstrated that caulerpin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique