Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU041881

Sigma-Aldrich

MISSION® esiRNA

targeting human SNCG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACACCCACCATGGATGTCTTCAAGAAGGGCTTCTCCATCGCCAAGGAGGGCGTGGTGGGTGCGGTGGAAAAGACCAAGCAGGGGGTGACGGAAGCAGCTGAGAAGACCAAGGAGGGGGTCATGTATGTGGGAGCCAAGACCAAGGAGAATGTTGTACAGAGCGTGACCTCAGTGGCCGAGAAGACCAAGGAGCAGGCCAACGCCGTGAGCGAGGCTGTGGTGAGCAGCGTCAACACTGTGGCCACCAAGACCGTGGAGGAGGCGGAGAACATCGCGGTCACCTCCGGGGTGGTGCGCAAGGAGGACTTGAGGCCATCTGCCCCCCAACAGGAGGGTGAGGCATCCAAAGAGAAAGAGGAAGTGGCAGAGGAGGCCCAGAGTGGGGGAGACTAGAGGGCTACAGGCCA

Numéro d'accès Ensembl | humain

ENSG00000173267

Numéro d'accès NCBI

NM_003087

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SNCG(6623) , SNCG(6623)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Changru Fan et al.
Cytogenetic and genome research, 154(4), 209-216 (2018-06-15)
The aim of the study was to evaluate the effects of synuclein-γ (SNCG) silencing on gastric cancer SGC7901 cells and to elucidate the associated mechanisms. pGCSIL-lentiviral siRNA targeting of the SNCG gene was employed to inhibit SNCG expression. Several experiments
Jingsong He et al.
Journal of breast cancer, 17(3), 200-206 (2014-10-17)
Synuclein-γ (SNCG), which was initially identified as breast cancer specific gene 1, is highly expressed in advanced breast cancers, but not in normal or benign breast tissue. This study aimed to evaluate the effects of SNCG siRNA-treatment on breast cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique